California Pepper Commission

Project Report 2008-2009:

DNA Fingerprinting of Powdery Mildew Strains on Peppers

Project Leader:

Mike Coffey, Professor and Plant Pathologist,
Department of Plant Pathology and Microbiology,
University of California,
Riverside, CA 92521
Phone (951) 827–4764
E-Mail: coffey@ucr.edu

Location of Work: UC Riverside Campus

Budget Total: $28,000 ($12,100 FROM CPC Grant)

Project Year: March 1, 2008 to February 28, 2009

Background and Objectives:

Field observations on powdery mildew suggest that strains of powdery mildew on pepper and tomato may be different. For example in 2007 powdery mildew appeared early on peppers in several regions but was not observed until much later in the season on tomatoes. In addition, the same powdery mildew is a pathogen on other crops such as artichoke. We have no knowledge of strain diversity or the behavior of strains on one host relative to another. In fact several different phylogenetic species may be present in California and cause problems on pepper. This research addresses this issue through sampling and DNA-based characterization of different strains collected in several different pepper-growing regions of the state. We have used a powerful molecular method AFLP that provides a genetic fingerprint of prevalent strains and give insight into the genetic diversity of the powdery mildew Leveillula. In addition, we used an approach designed to differentiate different species of powdery mildew which utilizes the ITS region of the ribosomal gene. Differences in this ITS region can indicate the presence of different species and to verify this we used two other powdery mildew species, from tomato (Oidium) and melon (Podosphaera/Sphaerotheca).

TABLE 1

The following Samples of Powdery Mildew were received from the Field:

Sample Code	Samples	Date Received	Received From	Field Location
V1	Hiji Bells	8-21-08	David Holden Ventura, CA	Latitude: N34° 11.7912 Longitude: W119° 9.6166
W1	Pepper Leaves	9-4-08	Woodland, CA	Seminis
D1	Pepper Leaves	9-19-08	Ken Owens Dixon, CA	Latitude: N38°.439491 Longitude: W121° .822837
D2	Pepper Leaves	9-30-08	Ken Owens Dixon, CA	Latitude: N38°.445 Longitude: W121° .822
S1	Hollister	2003
S2	Hollister Bag #1	10-1-08	United Genetics Gilroy, Calif.	Ochoa Trial, east of Outlet Mall
S3	Bag #2	10-1-08	United Genetics	M. Chuck Field
S4	Bag #3	10-1-08	United Genetics	8000 Fairview Rd
S5	Bag #4	10-1-08	United Genetics	Koroda Field

Powdery Mildew Greenhouse Samples

Sample Code	Samples	Date Received	Date Greenhouse was Inoculated & Location	DNA Extraction Date for AFLP Analysis
Sg	Leveillula Hollister	2003	2003/13C	11-6-08
Wg	Leveillula Woodland	09-04-08	9-05-08/Poly 5	12-05-08
Vg	Leveillula Ventura	08-21-08	8-22-08/Ag-Opís	12-05-08
Mg	Podosphaera Melon	----	------	--------
Tg	Oidium Tomato	----	------	--------

ITS region of the Ribosomal Gene

Material & Methods

Isolates.– Pepper isolates in this study are listed (Table 1), together with one Melon and one Tomato powdery mildew isolate that were used as outgroups. From these samples, spores were collected from several colonies using a wire loop from several different infected leaves. Collected spores were then placed in a lysing tube with 1000µl of CLS VF DNA solubilising solution. DNA was extracted from approximately 25mg of spores using a simplified FastDNA Extraction Procedure protocol.

Protocols

ITS– Standard PCR conditions were applicable for the DNA. Reaction mixtures were prepared using 2ul template DNA, 200uM dNTPís, 1U Taq DNA Polymerase (AmpliTaq; Applied Biosystems, Foster City, Ca), 2.5mM MgCl2 and 2µl of each primer in a reaction volume of 50µl. Using the following cycling protocol: an initial denaturing step of 35 cycles at 94°C for 4 min; 35 cycles at 94°C for 30 seconds, 35 cycles at 56°C for 40 seconds and 35 cycles at 72°C for 1 min. The final step is at 72°C for 5 minutes and the PCR rests at 4° when complete. All PCR products were evaluated for successful amplification using electrophoresis gels.

Sequences generated using ITS and specific primers

Table (2)

Primer Name

ITS 1 and 4

Sample Code

V1-(Ventura)

Generated Sequence

GGGAGGGCCGAGGTCTTCACGCTCTGTAATGATCCTTCCGTAGGGTGAACCTGCGGAAGGATCATTACAGAGCGTGAAGACCTCGGCCCCTCCACAGCGCAAGCTGGTGCGAGGGACACATGCCGGGGTCGACCCTCCCACCCGTGTCGACTCGTCTCCTGTTGCTTTGGCAGGCCGACTGCCTAGCGGTCCTCTGGCTCTCGGGCTGGAGTGCGCCTGCCAGAGACTATTCAACTCGTGTTCTGGATGAAGTCTGAGCAATCAAGCAATAAAAATGAATAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAACCCGTCGAGCCGACTAGGCTTGGTCTTGGGGCTCGCCCGCATTTGGCGCGGCGGCTCTTAAACGCAGTGGCGGTGCCGGTGGTGCTTTCCGCGTAGTCACATTTCTCGCGCGAGGGCAGAATCCGGACCCAGCCAGCAACCACAAAGTCCGCAGCGCTCTGCGCGGCGACTTTTGTACTTCTTCTGGTTGACCTCGAATCACAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

NCBI Blast Results: Leveillula taurica strain WSP71133 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence, 99%

Primer Name

ITS 1 and 4

Sample Code

W1-(Woodland)

Generated Sequence

TTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATTCGAGGTCAACCAGAAGAAGTACAAAAGTCGCCGCGCAGAGCGCTGCGGACTTTGTGGTTGCTGGCTGGGTCCGGATTCTGCCCTCGCGCGAGAAATGTGACTACGCGGAAAGCACCACCGGCACCGCCACTGCGTTTAAGAGCCGCCGCGCCAAATGCGGGCGAGCCCCAAGACCAAGCCTAGTCGGCTCGACGGGTTGTTATGACGCTCGAACAGGCATGCCCCTAGGAGTACCCAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTAAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTCATTTTTATTGCTTGATTGCTCAGACTTCATCCAGAACACGAGTTGAATAGTCTCTGGCAGGCGCACTCCAGCCCGAGAGCCAGAGGACCGCTAGGCAGTCGGCCTGCCAAAGCAACAGGAGACGAGTCGACACGGGTGGGAGGGTCGACCCCGGCATGTGTCCCTCGCACCAGCTTGCGCTGTGGAGGGGCCGAGGTCTTCACGCTCTGTAATGATCTCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTCACCTTCA

Primer Name

ITS 1 and 4

Sample Code

Sg(Greenhouse Hollister Strain)

Generated Sequence

CATTACAGAGCGTGAAGACCTCGGCCCCTCCACAGCGCAAGCTGGTGCGAGGGACACATGCCGGGGTCGACCCTCCCACCCGTGTCGACTCGTCTCCTGTTGCTTTGGCAGGCCGACTGCCTAGCGGTCCTCTGGCTCTCGGGCTGGAGTGCGCCTGCCAGAGACTATTCAACTCGTGTTCTGGATGAAGTCTGAGCAATCAAGCAATAAAAATGAATAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTGGGTACTCCTAGGGGCATGCCTGTTCGAGCGTCATAACAACCCGTCGAGCCGACTAGGCTTGGTCTTGGGGCTCGCCCGCATTTGGCGCGGCGGCTCTTAAACGCAGTGGCGGTGCCGGTGGTGCTTTCCGCGTAGTCACATTTCTCGCGCGAGGGCAGAATCCGGACCCAGCCAGCAACCACAAAGTCCGCAGCGCTCTGCGCGGCGACTTTTGTACTTCTTCTGGTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGAA

Primer Name

ITS 1 and 4

Sample Code

Mg (outgroup)

Generated Sequence

CCTGATCCGAGGTCTCCAAGACTGGGGTTCTGGCGGGGGCCGTCGCCCTCTGTCCATATATGATGACTACGCGGAGAGTCACCGGCACCGCCACTGCGTTTAGGGGCCGCCGAGCCGGCGAGCCCCAAGACCAAGCTAGGCTTGAGGGGTGTTCTGACGCTCGAACAGGCATGCCCCTCGGAATGCCGGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTAAATTCTGCAATTCACATTACTTATCGCATTTCCCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTACTAATTCCACATTTCCTCAGACAACACTCACAGCACGAGTTGGGGCTTCTCTGACGGGCACTCGCCAGCCGGAGCCGGCAGGTCGAGCCCGGCCCGCCAAAGCAACAGATAAAAGTTCACGCGGGTGGAGGGTCAACCGCCGCAGCGCGTGCGCGCTGCGGGGCCTCGCGCTCAGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTCGCCTTCAGGCAGGCAAAGAGCATGCTTCCCCCCGCCCCTAACGCGAACAGTTTGTTTTTAAACGCGTTCGCGGGTCGTTTGATGTTTAGGCATCGACAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTCACCTTCA

NCBI Blast Results: Sphaerotheca fusca internal transcribed spacer, complete sequence, 85%

Podosphaera fusca 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence, 86%

Primer Name

ITS 1 and 4

Sample Code

Tg (outgroup)

Generated Sequence

CATTACAGAGCGTGAGGCTCAGTCGTGGCGTCAGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTCTATCTTGTTGCTTTGGCGGGCCGGGCTACGTCGTCGCTGCCCGTACGGACATGTGTCGGCCGCCCACCGGTTTCGACTGGAGCGCGTCCGCCAAAGACCTAACCAAAACTCATGTTGTCTTTGTCGTCTCAGCTTTATTATTGAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGTTGCGGTGTTGGGGCCCGTCGCGTTGCGGCAGCTCTTAAAGATAGTGGCGGTCCTGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACAGTGGCTTGCCAAAAGCCCGTTTGTTCCAGTCACATGGATCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

NBCI Blast Results: Oidium sp. DNA231 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, 100%

Phylogenetic Tree for ITS Pepper Powdery Mildew with Tomato Powdery

Mildew (Oidium) Out Group

Phylogenetic Tree for ITS Pepper Powdery Mildew with Melon powdery mildew

(Podosphaera) Out Group

Further Analysis

The original DNA strains were further analyzed by amplifying the DNA using standard amplifying conditions for Genomiphi and continuing with the use of the amplified and non-amplified DNA, AFLP analysis was performed.

Materials and Methods for Amplifying DNA

Selection of isolates and DNA extraction:

Selected Powdery Mildew isolates are Hollister, (Sg), Ventura (V1) and Woodland (W1) which were collected from the greenhouse and field. Spores were collected from several different colonies from the infected pepper leaves using a wire loop.

DNA was extracted from 2 to 200 mg of spores using the FastDNA extraction kit and diluted to 10 ng/µL for Genomiphi and AFLP analysis.

Amplifying the Genomic DNA Using Genomiphi

For denature template DNA, 2.5µl of 10 ng/µL genomic DNA was heated to 95°C for 3 minutes with 22.5 µl sample buffer. For amplify genomic DNA, mix the denatured DNA and Enzyme mix, and reaction buffer, incubate at 30°C for 4 hours. The amplified genomic DNA was then used for AFLP analysis. Initial analysis with the genomiphi amplified DNA was unsuccessful using AFLPís, so for further AFLP analysis we used non-amplified genomic DNA, Sg, Vg and Wg collected from the greenhouse.

Materials and Methods for AFLP Analysis

Amplified Fragment Length Polymorphism (AFLP)

AFLP markers are highly polymorphic and reproducible and thus represent a powerful technique for DNA analysis that has revolutionized fingerprinting and genetic diversity studies. AFLP analysis detects genetic variation throughout the genome by using a pair of specific restriction enzymes and their corresponding adapters combined with PCR. Because PCR primers are based on the sequences of the restriction enzyme and universal adapters to which they are ligated, the procedure requires no prior information about the nucleotide sequences under investigation. Polymorphisms are detected by using a number of selective bases following the restriction site. The AFLP technique was originally developed in plants with genome sizes from 1?108 to 6?109 bp. Researchers have investigated the effect of increasing the number of selective bases to reduce the complexity of banding patterns obtained for species with large genomes.

Materials and Methods for AFLP Analysis

Materials:

Pepper leaves infected with Powdery Mildew were collected from three different greenhouses, which contains three different strains. Spores were harvested from the face of several pepper leaves using a wire loop, and genomic DNA was isolated from these spores. We obtained a total of six samples from three different populations, consisting of the following: Sg-A, Sg-B, and Vg-A, Vg-B and Wg-A, Wg-B.

Structure of adapters and primers:

Adapters and primer sequences for ligation and PCR amplification were modified from those published in the standard AFLP protocol. Controls with the standard 2 or 3 selective bases on the EcoR I primer and 3 selective bases on the Mse I primer were also included for standardization. EcoR I primers will be 5'-GACTGCGTACCAATTC + x (where x = ACC, AT, AG, AC, TG, or A) and Mse I primers will be 5'-GATGAGTCCTGAGTAA + y (where y = CTA, CAG, CTC, or C).

Restriction enzyme digestion and ligation of adapters:

Genomic DNA (250 ng) was digested with Mse I, a restriction enzyme with a 4-bp recognition site, combined with EcoR I, an enzyme with a 6-bp recognition site. Digestion was performed at 37°C for 3 hrs. Restriction fragments was ligated to the appropriate adapter sequences at 37°C for 3 hrs.

PCR amplification:

Ligations were diluted 10-fold in TE (10 mM Tris, 0.1 mM EDTA; pH 8.0) and used as templates in the PCR reaction using 9 different combined primer pairs, which consist of the following:

E-A + M-CG
E-CA + M-CG
E-TC + M-CG
E-A + M-A
E-CA + M-A
E-TC + M-A
E-A + M-AG
E-CA + M-AG
E-TC + M-AG

where E and M represent the EcoR I and Mse I primers, respectively).

Detection of bands:

Amplified products were separated by means of electrophoresis with 4% denaturing polyacrylamide gels in 1? TBE buffer. The gel was fixed in 10% Glacial acetic acid, silver stained, developed and scored for polymorphism between the isolates.

Detailed banding pattern analysis:

1. Amplifed restriction-ligation DNA using primer pair E-A+M-CG showed four banding patterns that were the same Mse1-EcoR1 fragment for all six samples. Two banding patterns were specific to Sg-B and Wg-A, while two banding patterns were specific for Vg-B.

2. Amplifed restriction-ligation DNA using primer pair E-CA + M-CG showed three banding patterns that were the same for all six samples. Two banding patterns were specific to Wg-A, Wg-B and Sg-B, while one of the banding patterns was specific for Vg-B.

3. Amplifed restriction-ligation DNA using primer pair E-TC + M-CG showed no same banding patterns for all six samples. There were three banding patterns specific to Wg-A, Wg-B, Sg-A and Sg-B, while there was one banding pattern specific to Vg-B, Wg-A and Wg-B.

4. Amplifed restriction-ligation DNA using primer pair E-A + M-A showed no same banding patterns for all six samples. There were four banding patterns specific to Wg-A, Wg-B and Sg-B, and four banding patterns specific to Wg-A and Sg-B.

5. Amplifed restriction-ligation DNA using primer pair E-CA + M-A showed three banding patters that were the same for all six samples. Two banding patterns were specific to Wg-B, two specific to Vg-B and one specific to Vg-A.

6. Amplifed restriction-ligation DNA using primer pair E-TC + M-A showed two banding patterns that were the same for all six samples. Two specific to Wg-A, Wg-B and Sg-B and one band specific for Vg-B.

7. Amplifed restriction-ligation DNA using primer pair E-A + M-AG showed no same banding patterns for all six samples. Three banding patterns were specific to Wg-A and Sg-B.

8. Amplifed restriction-ligation DNA using primer pair E-CA + M-AG showed three banding patterns that were the same for all six samples. Two banding patterns were specific to Wg-A and Sg-B and one was specific to Sg-A

9. Amplifed restriction-ligation DNA using primer pair E-TC + M-AG showed one banding pattern that was the same for all six samples. Two banding patterns were specific to Wg-A, Wg-B and Sg-B.

Photographs of the AFLP gels used in scoring these bands are available upon request.

Summary of main features of the AFLP fingerprint paterns

Amplification of restriction-ligation DNA templates with the PCR primer combinations yielded banding patterns consisting of approximately 170 fragments, of which 13 were single bands.

Samples Wg-A, Wg-B and Sg-B shared 39 bands out of 170.

Wg-B and Sg-B share only 18 bands.

Vg-B, Wg-A and Wg-B shared only 3 bands.

CONCLUSIONS

AFLP analysis revealed large differences in the genetic makeup of different strains of pepper powdery mildew. Most of the data was obtained from samples obtained from Hollister, Ventura and Woodland. Analysis of the ITS region of these strains confirmed that they are Leveillula taurica. However this species is regarded as a species complex and in comparisons made with two other powdery mildew species used as outgroups it was clear that large differences existed in the ëgenetic fingerprintsí of different strains. Specifically the Woodland strain was very different from strains collected in Ventura and Hollister based on both AFLP and ITS analysis. These differences indicate that the pepper powdery mildew population in California is probably extremely diverse. These differences might also be reflected in behavioral differences in biology, pathology and epidemiology.